Novogene’s amplicon metagenomic sequencing services offer a cost-effective approach compared to Shotgun Metagenomic Sequencing to screen for target organisms and provide insights into the diversity of complex microbial communities. This approach is widely utilized in microbial ecology studies, phylogenetic analysis of specific microbial groups, species identification in pure cultures, and the detection of organisms of interest, whether pathogenic or beneficial, among other applications.
How Does 16S/18S/ITS Amplicon Metagenomic Sequencing Work?
- Amplicon metagenomic sequencing is a powerful method for exploring the full spectrum of microorganisms in diverse samples. This technique is particularly effective for:
- Targeting and identifying specific organisms of interest within complex microbial populations.
- Annotating and classifying a wide array of microorganisms, providing a comprehensive profile of microbial communities.
- Differentiate between bacteria and archaea (16S)and other eukaryotes like fungi or protists(ITS/18S) for precise taxonomic analysis.
- Detecting pathogens, microbial contamination, beneficial soil bacteria, and other relevant microorganisms.
- Analyzing physiological fluids or tissue samples to assist in the diagnosis of diseases and cancers.
- This approach offers detailed insights into microbial diversity, making it an invaluable tool in various research and diagnostic applications.
Advantages
Novogene leverages extensive experience in amplicon sequencing projects and has recently developed cutting-edge pipelines that include short-read and long-read (16S Full-Length Amplicon Sequencing) technologies for amplicon metagenomic sequencing.
Our services provide unparalleled flexibility in experimental design, including customized primer design, and support comprehensive analyses through clustering into OTUs (Operational Taxonomic Units) via the Qiime1 pipeline or denoising into ASVs (Amplicon Sequence Variants) using DADA2 within the Qiime 2 pipeline. Furthermore, we offer tailored solutions with customized analyses and databases through both Qiime 1 and Qiime 2 pipelines, ensuring precise alignment with specific research requirements.
Primers applied to Amplicon Metagenomic Sequencing
| Types | Amplified Region | Fragment Length | Primers | Sequences (5’- 3’) | |
| Bacterial 16S | V4 | 300 bp | 515F | GTGCCAGCMGCCGCGGTAA | |
| 806R | GGACTACHVGGGTWTCTAAT | ||||
| V3-V4 | 470 bp | 341F | CCTAYGGGRBGCASCAG | ||
| 806R | GGACTACNNGGGTATCTAAT | ||||
| V4-V5 | 450 bp | 515F | GTGCCAGCMGCCGCGGTAA | ||
| 907R | CCGTCAATTCCTTTGAGTTT | ||||
| V5-V7 (for endophytic) | 435 bp | 799F | AACMGGATTAGATACCCKG | ||
| 1193R | ACGTCATCCCCACCTTCC | ||||
| Archaea V4 (AKA. Novel Archaea V4) |
V4-V5 | 415 bp | Arch519F | CAGCCGCCGCGGTAA | |
| Arch915R | GTGCTCCCCCGCCAATTCCT | ||||
| Types | Amplified Region | Fragment Length | Primers | Sequences (5’- 3’) | |
| Fungal 18S | V4 | 350 bp | 528F | GCGGTAATTCCAGCTCCAA | |
| 706R | AATCCRAGAATTTCACCTCT | ||||
| Fungal ITS | ITS1 | 200-400 bp | ITS5-1737F | GGAAGTAAAAGTCGTAACAAGG | |
| ITS2-2043R | GCTGCGTTCTTCATCGATGC | ||||
| ITS2 | 380 bp | ITS3-2024F | GCATCGATGAAGAACGCAGC | ||
| ITS4-2409R | TCCTCCGCTTATTGATATGC | ||||
| ITS1-1F (for endophytic) | 200-400 bp | ITS1-1F-F | CTTGGTCATTTAGAGGAAGTAA | ||
| ITS1-1F-R | GCTGCGTTCTTCATCGATGC | ||||
Specifications: DNA Sample Requirements
| Sample Type | Amount | Volume | Concentration | Purity |
| Total DNA | ≥ 200 ng | ≥ 20 μL | ≥ 10 ng/μL | OD260/280 = 1.8-2.0, No degradation, no contamination, no color |
Specifications: Sequencing and Analysis
| Sequencing Platform | Illumina NovaSeq 6000 | |
| Sequencing Strategy | NovaSeq Reagent (500 Cycles) | |
| Data Output | 50K/100K/500K raw tags | |
| Qiime1 or Qiime2 | Standard Analysis | Data Quality Control
OTU/ASV Clustering Taxonomic Annotation Alpha and Beta Diversity Analyses (UPGMA, PCA, PCoA, NMDS) Community Differences Analyses (Anosim, MRPP, Simper) Statistical Analyses (T-Test, MetaStat, LEfSe) Function Prediction (Qiime2 Only) |
| Advanced Analysis | Spearman, CCA/RDA, VPA analysis
Network analysis Function prediction analysis |
|
Project Workflow
Novogene provides high-quality products and expert services throughout the entire project workflow. Every step is carefully designed and executed to meet rigorous scientific standards, ensuring exceptional research outcomes. To guarantee the accuracy and reliability of sequencing data, stringent quality control (QC) measures are implemented at each stage of the process. The workflow encompasses key steps such as sample preparation and quantification, fragmentation and library preparation, library quality control, sequencing, and bioinformatics analysis.







